search for




 

Induction of Myogenic Differentiation in Myoblasts by Electrical Stimulation
J Korean Soc Phys Med 2019;14(2):63-70
Published online May 31, 2019;  https://doi.org/10.13066/kspm.2019.14.2.63
© 2019 Journal of The Korean Society of Physical Medicine.

Hyeon-Jeong Je, Min-Gu Kim, Il-Hoon Cho1,2,† , and Hyuck-Joon Kwon

Department of Physical Therapy and Rehabilitation, College of Health Science, Eulji University,
1Department of Biomedical Laboratory Science, College of Health Science, Eulji University,
2Program for BK21+ Senior Healthcare, Graduate school, Daejeon, Republic of Korea
Il-Hoon Cho, Hyuck-Joon Kwon hyuckjoon5413@gmail.com, ihcho@eulji.ac.kr
Received April 4, 2019; Revised April 9, 2019; Accepted April 22, 2019.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

PURPOSE:

While electrical stimulation (ES) is known to be a safe and flexible tool in rehabilitation therapy, it has had limited adoption in muscle regeneration. This study was performed to investigate whether ES can induce myogenic differentiation and to clarify the mechanism underlying the effects of ES on myogenic differentiation.

METHODS:

This study used rat L6 cell lines as myoblasts for myogenic differentiation. Electric stimulation was applied to the cells using a C-Pace EP culture pacer (IonOptix, Westwood, Ma, USA). The gene expressions of myogenic markers were examined using qPCR and immunochemistry.

RESULTS:

Our study showed that ES increased the thickness and length of myotubes during myogenic differentiation. It was found that ES increased the expression of myogenic markers, such as MyoD and Myogenin, and also activated the fusion of the myoblast cells. In addition, ES suppressed the expression of small GTPases, which can explain why ES promotes myogenic differentiation.

CONCLUSION:

We found that ES induced myogenic differentiation by suppressing small GTPases, inhibiting cell division. We suggest that ES-based therapies can contribute to the development of safe and efficient muscle regeneration.

Keywords : Electrical stimulations, Myoblast, Myogenesis, Small GTPase
I. Introduction

With gradual increase in lifespan, increased number of elderly people are suffering from sarcopenia or muscle dystrophy. These muscle disorders can be major causes of brain disease or diabetes, as well as decreased motor function [1-3]. Muscle tissues are often damaged by tissue loss due to congenital defects, large traumas, tumors removal, sarcopenia, and muscle atrophy. Although autologous or allogenic stem cell-based cell therapies have been attempted for repairing damaged muscle tissues, these have some limitations, such as the low efficiency of muscle regeneration, survival rate of the source cells at the injured site, and immune rejection response [4]. Therefore, it would be necessary to develop a novel technique for inducing myogenic differentiation while providing high efficiency and high safety for muscle regeneration [5].

Since previous studies have identified growth factors and cytokines involved in myogenic differentiation, therapies based on the biochemical factors and genetic manipulation for inducing myogenic differentiation have been developed; however, many limitations have been identified with respect to their clinical application. These limitations include high time consumption, high cost, and high risks, such as increased risk of teratomas formation [6,7]. Recent studies have shown that physical factors can influence many cellular functions [8,9]. It has been established that an electrical reaction is generated during physiological activities in various tissues within the body and is associated with various pathological phenomena [10,11]. Previous studies showed that electrical stimulation induces cellular responses through voltage-dependent channels, ionic channels, signaling by gap junctions, changes in ion distribution in the extracellular matrix, and activation of cell secretion [12-14]. These results implicate that electrical stimulations can influence cell differentiation by modulating various signal transductions. Previous studies have used electrical stimulation for inducing muscle contraction after myotube formation [15,16]. Although some studies reported that electrical stimulation has positive effects on myogenic differentiation [17], they were unable to clarify the underlying mechanism behind the effects of electrical stimulation on myogenic differentiation. Therefore, in the present study, we investigated whether electrical stimulation can promote myogenic differentiation and evaluated the possible mechanism underlying the effects of electrical stimulation on myogenic differentiation.

II. Methods

1. Cell culture

Rat L6 myoblast cells were maintained in Dulbecos’s modified Eagle’s medium (DMEM; Welgene, Seoul Korea), supplemented with 10% fetal bovine serum (FBS; RMBIO, USA) (Growth medium) and 1% antibioticantimycotic (Anti-anti; Gibco, USA) at 37°C in a humidified atmosphere of 5% CO2. L6 myoblast cells were seeded in 35 mm dishes at the density of 3 × 105 cells/mL for differentiation into myotube. After 48 hours of incubation, the culture media were replaced by DMEM, which included 2% FBS (Differentiation medium) and 1% Anti-anti; then, the differentiating medium was replaced every 2 days.

2. Electrical stimulation (ES)

ES was applied to L6 Rat skeletal myoblast cells using a C-Pace EP culture pacer (IonOptix, Westwood, Ma, USA), which is a multi-channel stimulator designed for chronic stimulation of bulk quantities of the cultured cells. This device contacts the carbon electrodes in the 35 mm dish (ThermoFisher Scientific, USA) and emits bipolar pulses. ES - with an electrical field of 1 V/cm, duration of 5 ms, and frequency of 1 Hz - was continuously applied to the L6 cells after the cells reached 80%~90% of confluency for 7 days. After ES treatment, cell lysis was performed with Trizol solution (Invitrogen) for gene expression analysis.

3. qPCR analysis

Total RNA was isolated from various L6 Rat skeletal muscle cell line cultures using the Direct-zol™ RNA MiniPrep (Zymo Research Corporation, Irvine, CA, U.S.A.) in accordance with the manufacturer’s protocol. RNA concentrations were determined using a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA), and reverse transcription reactions were performed using .2 μg of total RNA with a TOPscript cDNA synthesis kit (enzynomics, Daejeon, Korea). The real-time PCRs for MyoD (Myogenic Differentiation 1), myogenin (myogenic factor 4), ECT2 (Epithelial Cell Transforming 2), DOCK1 (Dedicator of cytokinesis protein 1), LRRK2 (Leucine-rich repeat kinase 2), and VAV2 (Vav guanine nucleotide exchange factor 2) were performed using TOPreal qPCR 2X Premix SYBR Green (enzynomics, Daejeon, Korea). Primer sequences are described in Table 1. Real-time PCRs were performed with a StepOnePlus™ instrument (Applied Biosystems, Grand Island, NY, USA) at 95°C for 15 min, followed by 40 cycles of denaturation at 95°C for 10 sec, extension at 60°C for 15 sec, and annealing at 72°C for 15 sec. Gene expression levels were normalized to that of GAPDH Housekeeping gene, and relative gene expression was computed using the ddCT method.

The Primer Sequences for qPCR Analysis of Myogenic Markers and Small GTPases

GeneForward primers (5`-3`)Reverse primers (5`-3`)
MyoD1GCGACAGCCGATGACTTCTATGGTCCAGGTCCTCAAAAAAGC
MyogeninGACCCTACAGGTGCCCACAAACATATCCTCCACCGTGATGCT
ECT2AGTTCCTCCAAAGCAGTCGGTCCTCGGGTGCAAGAATAGG
DOCK1CTGCCGAAGAAGATGCACTCAGGATCACAGCCTCAGACTG
LRRK2TGTCATCTCCACCATCCCAGCAATGCGATTCTGTGCTGGA
VAV2CTGCAAGACGGAAGACATGAATCTTGCAGGCTTTGCAGTT
GAPDHCCACCAACTGCTTAGCACCGCCAAATTCGTTGTCATACC

4. Immunofluorescence staining

The L6 myoblast cells were washed twice in phosphate buffered saline (PBS) and were fixed in 4% paraformaldehyde for 20 min at room temperature. Thereafter, the cells were washed three times using PBS. After blocking in PBS containing 5% goat serum and .3% Triton × 100 for 40 min at room temperature, the cells were incubated with rabbit anti-MHC (MF 20) antibody (1:10; DSHB, USA) at 4°C overnight, washed three times in PBS containing .1% Triton × 100, and then, incubated with Alexa594 conjugated secondary antibody (1:200; Invitrogen) for 60 min at room temperature in the dark. Subsequently, the cells were washed three times in PBS, containing .1% Triton × 100, and nuclei were stained with Hoechst 33258 (Dojindo, Tokyo, Japan). Finally, the cells were incubated for 5 minutes at room temperature and washed 3 times with PBS containing .1% Triton×100. The stained cells were visualized using a fluorescence microscopy (Olympus, Tokyo, Japan).

5. Fusion Index

The cells stained with MHC (Red) and Hoechst 33258 (Blue) were used. Three images were taken at random, using fluorescence microscopy (Olympus, Tokyo, Japan). Next, the total number of nuclei and the number of nuclei inside myotubes were calculated. The fusion index was calculated as the number of nuclei in myotubes divided by the total number of nuclei.

Fusion Index(%)=100×Number of the nuclei inside MyotubesTotal number of nuclei

6. Statistical analyses

SPSS version 24.0 (SPSS Inc., Chicago, IL, USA) was used to conduct all statistical analyses. All values were expressed as the mean±SD. Comparisons between the two mean values were evaluated using Paired t-test, and comparisons between three or more groups Ed note: values? were evaluated using one-way ANOVA, followed by LSD post-hoc analysis. Statistical significance was accepted at p-value<.05.

III. RESULTS

1. Electrical stimulation promotes myotube formation

The electric stimulation device allows carbon electrodes to be immersed in a culture medium containing the cells, and then the electricity can be flowed at an intensity of 1 v / cm, 5 ms and 1 Hz. After the L6 myoblast cells were cultured to reach a confluency of about 80 to 90%, the cells were cultured in the differentiation medium without electrical stimulation (DM) or with electric stimulation (ES). We found that the L6 cells treated with ES formed much thicker and larger myotubes than the non-treated L6 cells (Fig. 1). These results indicate that ES promotes myogenic differentiation.

Fig. 1.

Morphological observation of L6 differentiation, with or without electrical stimulation. L6 cells were cultured in the differentiation medium without electrical stimulation (Diff) or with electrical stimulation (Diff+ES). Scale bars, 100 μm


2. Electrical stimulation increases myogenic transcription factors

We then examined whether ES increases the expression levels of myogenic markers, such as MyoD and Myogenin. Thus, we performed qPCR analyses for analyzing the mRNA levels of the myogenic markers. It was shown that the differentiation medium (Diff) significantly increased gene expression of the myogenic markers, such as MyoD and myogenin on day 7, while ES significantly enhanced the gene expression of the myogenic markers, revealing a 2‐fold increase in MyoD and a 4.5‐fold increase in myogenin (Fig. 2). This suggests that ES more efficiently accelerates myogenic differentiation of myoblast cells (Fig. 2).

Fig. 2.

Electrical stimulation enhances mRNA expression of myogenesis markers and MHC ratio in L6 cells. (A) qPCR analysis of myogenic markers, MyoD, and Myogenin in L6 cells after culture for 7 days in the maintenance medium (CT), differentiation medium (DM), and differentiation medium with ES (ES). Data are presented as the means±standard deviations (S.D.). Statistical analyses were performed using ANOVA (LSD test); **p<.01, *p<.05


3. Electrical stimulation induces fusion of myoblast cells during myogenic differentiation

Immunostaining analysis showed that myotubes formed in the differentiation medium without ES or with ES expressed myosin heavy chain (MHC) strongly, whereas myoblast cells in the maintenance medium did not show strong expression (Fig. 3A). Moreover, the cells cultured in the differentiation medium with ES treatment showed a 2.5-fold higher myotube fusion than those cultured in the differentiation medium without ES (Fig. 3B). This indicates that ES promotes myogenic differentiation by activating the fusion processes.

Fig. 3.

(B) Immunofluorescent staining (Nuclei; blue) and myosin heavy chain (MHC; Red). Scale bars, 500 μm. (C) Fusion index analysis of immunofluorescent stained L6 cells. Fusion index was calculated as the number of nuclei in myotubes divided by the total number of nuclei. Statistical analyses were performed using paired t-test; **p<.01, *p<.05


4. Electrical stimulation suppressed small GTPase signaling during myotube formation

We examined whether ES influences the expression level of small GTPase, such as ECT2 (Epithelial Cell Transforming 2), DOCK1 (Dedicator of cytokinesis protein 1), LRRK2 (Leucine-rich repeat kinase 2), and VAV2 (Vav guanine nucleotide exchange factor 2). qPCR analyses showed that the expression levels of small GTPases in the cells cultured in the differentiation medium were lower than those in the cells cultured in the maintenance medium. Furthermore, it was found that ES more strongly suppressed the expression levels of small GTPases (Fig. 4). This implicates that ES-induced myogenesis is related to the suppression of small GTPases.

Fig. 4.

Electrical stimulation suppresses mRNA expression of small GTPase markers. qPCR analysis of small GTPase, ECT2, DOCK1, LRRK2, and VAV2 in L6s after culture for 7 days in the maintenance medium (CT), differentiation medium (DM), and differentiation medium with ES (ES). Data are presented as the means±standard deviations (S.D.). Statistical analyses were performed using ANOVA (LSD test); **p<.01, *p<.05


IV. Discussion

In this study, we demonstrated that ES accelerated the myogenic differentiation. We found that ES increased the thickness and length of myotubes and enhanced the expression of myogenic markers, including MyoD and Myogenin (Fig. 1, 2). In addition, ES activated the fusion of myoblasts during the formation of myotubes (Fig. 3). MyoD and myogenin are members of the MyoD family of transcription factors that have binding interactions with hundreds of muscular gene promoters, playing essential roles in myogenic differentiation [18]. MyoD is capable of converting fibroblasts or other differentiated cell types into the skeletal muscle lineage. Myogenin can induce undergo myogenic differentiation of myoblasts, leading to formation of multinucleated myofibres by fusing of myoblasts [18]. Therefore, our data suggests that ES promotes the myogenic differentiation and myotube formation by increasing MyoD and myogenin.

Previous studies reported the promotive effects of ES on the formation of myotubes by enhancing the expressions of MyoD, M-cadherin, and connexin 43 [18,19]. It was also reported in previous studies using C2C12 cells (mouse myoblast) that ES increased the expression of MHC [19]. In addition, ES pretreatment accelerated the myogenic differentiation of C2C12 cells [17]. However, most studies have used ES to study the effects of exercise on muscle cell contraction [15,16]; however, they failed to clearly illustrate the molecular mechanism behind the promotive effects of ES on myogenic differentiation. Small GTPases act as modulators in signal transduction, cell division and growth, vesicle transport, cytoskeletal dynamics, and cell motility [20-23]. Ras GTPases are known to play an important role in human cancer with respect to cellular transformation and proliferation [26-28]. Rho GTPases are primarily involved in cell motility and cytoskeleton dynamics, and control the assembly of stress fibers and focal adhesions [24-29]. In the study using C2C12 myoblasts, RhoA, Rac1, and Cdc42 were found to be important regulators of myogenesis. The RhoA activity increases rapidly and transiently in myoblasts after incubation in the differentiation medium. While RhoA is essential for the initial process of myogenesis, its function must be suppressed prior to myoblast fusion [30]. Active RhoA reduces the stability and disrupts the location of the cell adhesion molecule, M-cadherin, which is essential for muscle fiber fusion [31]. Consistent with the previous results, our results showed that ES promoted the myoblast fusion and down-regulated the expression levels of the small GTPases, such as ECT2, DOCK1, LRRK2, and VAV2 (Fig. 4). These results indicate that ES promotes myoblast fusion by inactivating the small GTPases, ultimately leading to the promotion of myogenic differentiation. In addition, it was known that DOCK1 promotes cell division in various cell types [32]. Thus, it was speculated that ES stimulates myoblast fusion by suppressing cell divisions, inducing myogenic differentiation. However, further study is required to clarify the molecular mechanism underlying the inductive effects of electrical stimulation on myogenic differentiation.

V. Conclusion

We demonstrated that electrical stimulation promotes myogenic differentiation. We suggest that ES induces myogenic differentiation by suppressing small GTPase signaling. ES-based techniques can contribute to the development of a novel therapy for muscle regeneration with high safety, high efficiency, and low cost.

Acknowledgements

This paper was supported by Eulji University in 2015 and by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science (NRF-2016R1D1A1B03935005).

References
  1. Goodpaster BH, Park SW, and Harris TB et al. The loss of skeletal muscle strength, mass, and quality in older adults:the health, aging and body composition study. J Gerontol A Biol Sci Med Sci 2006;61 10:1059-64.
    Pubmed CrossRef
  2. Faulkner JA, Larkin LM, and Claflin DR et al. Age-related changes in the structure and function of skeletal muscles. Clin Exp Pharmacol Physiol 2007;34 11:1091-6.
    Pubmed CrossRef
  3. Dolbow DR, and Gorgey AS. Effects of use and disuse on non-paralyzed and paralyzed skeletal muscles. Aging Dis 2016;7 1:68-80.
    Pubmed KoreaMed CrossRef
  4. Sacco A, Doyonnas R, and Kraft P et al. Self-renewal and expansion of single transplanted muscle stem cells 2008;456 7221:502.
    Pubmed KoreaMed CrossRef
  5. Loebel C, and Burdick JA. Engineering stem and stromal cell therapies for musculoskeletal tissue repair. Cell Stem Cell 2018;22 3:325-39.
    Pubmed KoreaMed CrossRef
  6. Florini JR, and Magri KA. Effects of growth factors on myogenic differentiation. Am J Physiol 1989;256 4 Pt 1:C701-11.
    Pubmed CrossRef
  7. Herberts CA, Kwa MS, and Hermsen HP. Risk factors in the development of stem cell therapy. J Transl Med 2011;9:29.
    Pubmed KoreaMed CrossRef
  8. Guilak F, Cohen DM, and Estes BT et al. Control of stem cell fate by physical interactions with the extracellular matrix. Cell Stem Cell 2009;5 1:17-26.
    Pubmed KoreaMed CrossRef
  9. Kshitiz Park J, and Kim P et al. Control of stem cell fate and function by engineering physical microenvironments. Integr Biol (Camb) 2012;4 9:1008-18.
    Pubmed KoreaMed CrossRef
  10. Bassett CA, and Pawluk RJ. Electrical behavior of cartilage during loading. Science 1972;178 4064:982-3.
    Pubmed CrossRef
  11. Foulds I, and Barker A. Human skin battery potentials and their possible role in wound healing. The British Journal of Dermatology 1983;109 5:515-22.
    Pubmed CrossRef
  12. Smith SD, McLeod BR, and Liboff AR et al. Calcium cyclotron resonance and diatom mobility. Bioelectromagnetics 1987;8 3:215-27.
    Pubmed CrossRef
  13. Bezanilla F. How membrane proteins sense voltage. Nature Reviews Molecular Cell Biology 2008;9:323.
    Pubmed CrossRef
  14. Nakagawa S, Maeda S, and Tsukihara T. Structural and functional studies of gap junction channels. Curr Opin Struct Biol 2010;20 4:423-30.
    Pubmed CrossRef
  15. Nikolic N, Gorgens SW, and Thoresen GH et al. Electrical pulse stimulation of cultured skeletal muscle cells as a model for in vitro exercise - possibilities and limitations. Acta Physiol (Oxf) 2017;220 3:310-31.
    Pubmed CrossRef
  16. Kawahara Y, Yamaoka K, and Iwata M et al. Novel electrical stimulation sets the cultured myoblast contractile function to 'on'. Pathobiology 2006;73 6:288-94.
    Pubmed CrossRef
  17. Hashimoto S, Sato F, and Uemura R et al. Effect of Pulsatile Electric Field on Cultured Muscle Cells in Vitro 2012;10 1:1-6.
  18. Bentzinger CF, Wang YX, and Rudnicki MA. Building muscle:molecular regulation of myogenesis. Cold Spring Harb Perspect Biol 2012;4 2.
    Pubmed KoreaMed CrossRef
  19. Miller JB. Myogenic programs of mouse muscle cell lines:expression of myosin heavy chain isoforms, MyoD1, and myogenin. J Cell Biol 1990;111 3:1149-59.
    Pubmed CrossRef
  20. Pereira-Leal JB, and Seabra MCJJomb. Evolution of the Rab family of small GTP-binding proteins. 2001;;313 4:889-901.
    Pubmed CrossRef
  21. Takai Y, Sasaki T, and Matozaki TJPr. Small GTP-binding proteins 2001;81 1:153-208.
    Pubmed CrossRef
  22. Colicelli JJSS. Human RAS superfamily proteins and related GTPases 2004;2004 250:re13-re.
    Pubmed KoreaMed CrossRef
  23. Johnson DS, and Chen YHJCoip. Ras family of small GTPases in immunity and inflammation 2012;12 4:458-63.
    Pubmed KoreaMed CrossRef
  24. Krontiris TG. Cooper GMJPotNAoS. Transforming activity of human tumor DNAs 1981;78 2:1181-4.
    Pubmed KoreaMed CrossRef
  25. Milburn MV, Tong L, and Brunger A et al. Molecular switch for signal transduction:structural differences between active and inactive forms of protooncogenic ras proteins 1990;247 4945:939-45.
    Pubmed CrossRef
  26. Pylayeva-Gupta Y, Grabocka E, and Bar-Sagi DJNRC. RAS oncogenes:weaving a tumorigenic web 2011;11 11:761.
    Pubmed KoreaMed CrossRef
  27. Parri M, Chiarugi PJCC, and Signaling. Rac and Rho GTPases in cancer cell motility control 2010;8 1:23.
    Pubmed KoreaMed CrossRef
  28. Rousseau M, Gaugler M-H, and Rodallec A et al. RhoA GTPase regulates radiation-induced alterations in endothelial cell adhesion and migration 2011;414 4:750-5.
    Pubmed CrossRef
  29. Spiering D, Hodgson LJCa, and migration. Dynamics of the Rho-family small GTPases in actin regulation and motility 2011;5 2:170-80.
    Pubmed KoreaMed CrossRef
  30. Wei L, Zhou W, and Croissant JD et al. RhoA signaling via serum response factor plays an obligatory role in myogenic differentiation 1998;273 46:30287-94.
    Pubmed CrossRef
  31. Charrasse S, Comunale F, and Grumbach Y et al. RhoA GTPase regulates M-cadherin activity and myoblast fusion 2006;17 2:749-59.
    Pubmed KoreaMed CrossRef
  32. Feng H, Li Y, and Yin Y et al. Protein kinase A-dependent phosphorylation of Dock180 at serine residue 1250 is important for glioma growth and invasion stimulated by platelet derived-growth factor receptor alpha. Neuro Oncol 2015;17 6:832-42.
    Pubmed KoreaMed CrossRef


November 2019, 14 (4)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)